Top » Catalog » SNPs » PH2967

$18.00

PH2967
[PH2967]

PH2967
hg38 Position: ChrY:15213051..15213051
Ancestral: G
Derived: C
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2
Comments: Below L283 > Z584 > Z1296
Forward Primer: PH2967_F GCAAGGGAGATGAAAGAAGG
Reverse Primer: PH2967_R AATCGATGCTCCTCATCACC
Reviews

Customers who bought this product also purchased
Z1297
Z1297
Z1043
Z1043
Z1296
Z1296
Z638
Z638
YP129
YP129
M241
M241
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies