Top » Catalog » SNPs » PH2967

$18.00

PH2967
[PH2967]

PH2967
hg38 Position: ChrY:15213051..15213051
Ancestral: G
Derived: C
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2
Comments: Below L283 > Z584 > Z1296
Forward Primer: PH2967_F GCAAGGGAGATGAAAGAAGG
Reverse Primer: PH2967_R AATCGATGCTCCTCATCACC
Reviews

Customers who bought this product also purchased
Z638
Z638
YP129
YP129
M241
M241
PH3120
PH3120
J2b-M12 Panel
J2b-M12 Panel
Z1295
Z1295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies