Top » Catalog » SNPs » A22144

$18.00

A22144
[A22144]

A22144
hg38 Position: ChrY:19346388..19346388
Ancestral: C
Derived: T
Reference: Moishe Miller (2018)
ISOGG Haplogroup: J1
Comments: Below ZS2740
Forward Primer: A22144_F GGCTGCCTGATGGAATTTAG
Reverse Primer: A22144_R TGGTAAAAACTTGACACGTAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies