Top » Catalog » SNPs » Y144785

$18.00

Y144785
[Y144785]

Y144785
hg38 Position: ChrY:14411857..14411857
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: Below ZS2740
Forward Primer: Y144785_F TGAGAGTCACAGCAGGATGC
Reverse Primer: Y144785_R ACGGGATTTAGGAAAACAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies