Top » Catalog » SNPs » ZS2740

$18.00

ZS2740
[ZS2740]

ZS2740
hg38 Position: ChrY:17277237..17277237
Ancestral: G
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1
Comments: Below ZS2740
Forward Primer: ZS2740_F GGTGCCAATGTGTTCAAATG
Reverse Primer: ZS2740_R CTGGGATCTGAAGGCAAAAG
Reviews

Customers who bought this product also purchased
BY8
BY8
ZS1951
ZS1951
ZS12606
ZS12606
FGC1695
FGC1695
FGC31455
FGC31455
Y133592
Y133592
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies