Top » Catalog » SNPs » ZS2740

$18.00

ZS2740
[ZS2740]

ZS2740
hg38 Position: ChrY:17277237..17277237
Ancestral: G
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1
Comments: Below ZS2740
Forward Primer: ZS2740_F GGTGCCAATGTGTTCAAATG
Reverse Primer: ZS2740_R CTGGGATCTGAAGGCAAAAG
Reviews

Customers who bought this product also purchased
ZS12018
ZS12018
S4944
S4944
ZS2736
ZS2736
L817
L817
J1-S4924 Panel
J1-S4924 Panel
BY80
BY80
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies