Top » Catalog » SNPs » Y144772

$18.00

Y144772
[Y144772]

Y144772
hg38 Position: ChrY:21259814..21259814
Ancestral: T
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: Below ZS2740
Forward Primer: Y144772_F TCTGGAAAGGGTGAAAAAGC
Reverse Primer: Y144772_R GTCTTCCACAGGAGCTCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies