Top » Catalog » SNPs » Y77461

$18.00

Y77461
[Y77461]

Y77461
hg38 Position: ChrY:19790761..19790761
Ancestral: T
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: Y77461_F GGTGGCAGATCACTCATGAG
Reverse Primer: Y77461_R TTACAGGTGATGTGAGCCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies