Top » Catalog » SNPs » BY839

$18.00

BY839
[BY839]

BY839
hg38 Position: ChrY:8807751..8807751
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b
Comments: Below DF49 > Z17591
Forward Primer: BY839_F GTGGTAACATTGGACACTGTCG
Reverse Primer: BY839_R AATAGGCAGATACCAAGTCAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies