Top » Catalog » SNPs » Y93860

$18.00

Y93860
[Y93860]

Y93860
hg38 Position: ChrY:13357163..13357163
Ancestral: T
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Below CTS595 > Y4252
Forward Primer: Y93860_F TGCCCAATAGTTGGGATCTG
Reverse Primer: Y93860_R AGGGTTTCACCATGTTGGTC
Reviews

Customers who bought this product also purchased
BY172424
BY172424
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies