Top » Catalog » SNPs » FGC79409

$18.00

FGC79409
[FGC79409]

FGC79409
hg38 Position: ChrY:6826454..6826454
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R2
Comments: .
Forward Primer: FGC79409_F CCTCATCTAATGCTCTTGTCCTTC
Reverse Primer: FGC79409_R AAGTCTGGGATTATGTCAAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies