Top » Catalog » SNPs » FGC79637

$18.00

FGC79637
[FGC79637]

FGC79637
hg38 Position: ChrY:12232213..12232213
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R2
Comments: .
Forward Primer: FGC79637_F TGAGGCCAGGAGTTCAAGAC
Reverse Primer: FGC79637_R GCTGAAACCCATTCAGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies