Top » Catalog » SNPs » A22098

$18.00

A22098
[A22098]

A22098
hg38 Position: ChrY:2791712..2791712
Ancestral: T
Derived: C
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22098_F TTCAAATTCAGGGATGAATGC
Reverse Primer: A22098_R CAAACCCAACATCTTGAAAGG
Reviews

Customers who bought this product also purchased
DYS390
DYS390
A22105
A22105
YSEQ-Alpha
YSEQ-Alpha
A22104
A22104
A22109
A22109
Whole Genome Sequence
Whole Genome Sequence
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies