Top » Catalog » SNPs » A22099

$18.00

A22099
[A22099]

A22099
hg38 Position: ChrY:6841069..6841069
Ancestral: A
Derived: G
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22099_F AAGCTGCCATTAAAAACTTCTTTC
Reverse Primer: A22099_R TAGTTCAGCTATTGTGGAAGATAGTGC
Reviews

Customers who bought this product also purchased
A22104
A22104
A22109
A22109
Whole Genome Sequence
Whole Genome Sequence
A22102
A22102
A22108
A22108
A22100
A22100
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies