Top » Catalog » SNPs » A22099

$18.00

A22099
[A22099]

A22099
hg38 Position: ChrY:6841069..6841069
Ancestral: A
Derived: G
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22099_F AAGCTGCCATTAAAAACTTCTTTC
Reverse Primer: A22099_R TAGTTCAGCTATTGTGGAAGATAGTGC
Reviews

Customers who bought this product also purchased
A22107
A22107
A22098
A22098
A22106
A22106
DYS390
DYS390
A22105
A22105
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies