Top » Catalog » SNPs » A22101

$18.00

A22101
[A22101]

A22101
hg38 Position: ChrY:8810194..8810194
Ancestral: G
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22101_F ATCTTGGTTCAAGGAGAAGTTTACAAG
Reverse Primer: A22101_R CAGTCCCTGTGGGACTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies