Top » Catalog » SNPs » A22105

$18.00

A22105
[A22105]

A22105
hg38 Position: ChrY:15510513..15510513
Ancestral: C
Derived: T
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22105_F GGAGATAGGGGTAGGGCAG
Reverse Primer: A22105_R CATCTCCCTCTAGGAAAACCAG
Reviews

Customers who bought this product also purchased
A22104
A22104
A22110
A22110
A22098
A22098
A22103
A22103
A22109
A22109
DYS390
DYS390
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies