Top » Catalog » SNPs » A22106

$18.00

A22106
[A22106]

A22106
hg38 Position: ChrY:19255197..19255197
Ancestral: T
Derived: C
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22106_F GCGGTGAGGCTGGGGGG
Reverse Primer: A22106_R GAGGACCCTCAGCTTCAGTTC
Reviews

Customers who bought this product also purchased
DYS390
DYS390
A22102
A22102
A22108
A22108
YSEQ-Alpha
YSEQ-Alpha
A22101
A22101
A22107
A22107
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies