Top » Catalog » SNPs » A22110

$18.00

A22110
[A22110]

A22110
hg38 Position: ChrY:21178198..21178198
Ancestral: C
Derived: T
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22110_F CTTGGCATAGTGGACATGGC
Reverse Primer: A22110_R CCTGTCACCCGACTCACTC
Reviews

Customers who bought this product also purchased
A22102
A22102
A22107
A22107
YSEQ-Alpha
YSEQ-Alpha
A22101
A22101
A22106
A22106
Whole Genome Sequence
Whole Genome Sequence
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY35603
1 x BY35646
$36.00
Haplogroup Info
Other products
Currencies