Top » Catalog » SNPs » A22110

$18.00

A22110
[A22110]

A22110
hg38 Position: ChrY:21178198..21178198
Ancestral: C
Derived: T
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22110_F CTTGGCATAGTGGACATGGC
Reverse Primer: A22110_R CCTGTCACCCGACTCACTC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
A22101
A22101
A22106
A22106
Whole Genome Sequence
Whole Genome Sequence
A22100
A22100
A22105
A22105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies