Top » Catalog » SNPs » A22100

$18.00

A22100
[A22100]

A22100
hg38 Position: ChrY:8290929..8290929
Ancestral: G
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22100_F TTCAAAGGGAATGCTTCCAG
Reverse Primer: A22100_R AACCTGGCAGCAATACAACC
Reviews

Customers who bought this product also purchased
A22104
A22104
A22109
A22109
DYS390
DYS390
A22103
A22103
A22108
A22108
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY35603
1 x BY35646
$36.00
Haplogroup Info
Other products
Currencies