Top » Catalog » SNPs » A22100

$18.00

A22100
[A22100]

A22100
hg38 Position: ChrY:8290929..8290929
Ancestral: G
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: I1
Comments: Below Z58 > Z60 > L802
Forward Primer: A22100_F TTCAAAGGGAATGCTTCCAG
Reverse Primer: A22100_R AACCTGGCAGCAATACAACC
Reviews

Customers who bought this product also purchased
A22099
A22099
A22107
A22107
A22098
A22098
A22106
A22106
DYS390
DYS390
A22105
A22105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies