Top » Catalog » SNPs » YFC324906

$18.00

YFC324906
[YFC324906]

YFC324906
hg38 Position: ChrY:21754439..21754439
Ancestral: T
Derived: G
Reference: Antonios Kollias (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: YFC324906_F GAAATGGGATCATACAATATGTGG
Reverse Primer: YFC324906_R CCAATTAACAAACAGAGCACAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies