Top » Catalog » SNPs » FGC74572

$18.00

FGC74572
[FGC74572]

FGC74572
hg38 Position: ChrY:19362558..19362558
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: Aka Y135364
Forward Primer: FGC74572_F AATGGAATTAAAAACAAACAGCCTG
Reverse Primer: FGC74572_R GAATTTGACTTCTTCACGGTTTAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A426
1 x A720
$36.00
Haplogroup Info
Other products
Currencies