Top » Catalog » SNPs » Y33692

$18.00

Y33692
[Y33692]

Y33692
hg38 Position: ChrY:15354456..15354456
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I1
Comments: Below L803
Forward Primer: Y33692_F AAAACAGAAAGCTAGGAAAGTACAATG
Reverse Primer: Y33692_R CCCAAAATGCTGGGATTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies