Top » Catalog » SNPs » Y99301

$18.00

Y99301
[Y99301]

Y99301
hg38 Position: ChrY:15377065..15377065
Ancestral: T
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Below CTS595 > F25958 > Y106756
Forward Primer: Y99301_F CACAACCATGCAGCTAGGAG
Reverse Primer: Y99301_R TGGTAGTTTGGGTGGAGTGG
Reviews

Customers who bought this product also purchased
Y106756
Y106756
Prepaid Return Envelope
Prepaid Return Envelope
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies