Top » Catalog » SNPs » Y133364

$19.00

Y133364
[Y133364]

Y133364
hg38 Position: ChrY:13510774..13510774
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: Below L1029
Forward Primer: Y133364v2_F GCTGAGACAGGAGAATCATTTGAG
Reverse Primer: Y133364v2_R AACCAACATCTCCCACAACC
Reviews

Customers who bought this product also purchased
Y133354
Y133354
Y133351
Y133351
Y133386
Y133386
R1a-L1029 Dibra Cluster
R1a-L1029 Dibra Cluster
Y133380
Y133380
Y133367
Y133367
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies