Top » Catalog » SNPs » Y133364



hg38 Position: ChrY:13510774..13510774
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: Below L1029
Reverse Primer: Y133364v2_R AACCAACATCTCCCACAACC

Customers who bought this product also purchased
R1a-L1029 Dibra Cluster
R1a-L1029 Dibra Cluster
Quick Find
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products