Top » Catalog » SNPs » Y133383

$18.00

Y133383
[Y133383]

Y133383
hg38 Position: ChrY:8675420..8675420
Ancestral: T
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: Below L1029
Forward Primer: Y133383_F TTCCTTTCCTGTCTTTCATGTTG
Reverse Primer: Y133383_R CAACATTCAAAGATTCTTTTCAGC
Reviews

Customers who bought this product also purchased
Y133367
Y133367
Y133361
Y133361
Y133354
Y133354
Y133351
Y133351
Y133386
Y133386
R1a-L1029 Dibra Cluster
R1a-L1029 Dibra Cluster
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies