Top » Catalog » SNPs » DF73

$18.00

DF73
[DF73]

DF73
hg38 Position: ChrY:7337861..7337861
Ancestral: C
Derived: A
Reference: Greg Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2d1
Comments: downstream of Z253; parallel to L1066
Forward Primer: DF73_F CGACCAGTGGTCTCCACATAG
Reverse Primer: DF73_R TGATTCAATGCATAACATTTCTGTTAC
Reviews

Customers who bought this product also purchased
BY13693
BY13693
A10499
A10499
Z255
Z255
FGC41901
FGC41901
Z2195
Z2195
Z29749
Z29749
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies