Top » Catalog » SNPs » A13249

$18.00

A13249
[A13249]

A13249
hg38 Position: ChrY:17263129..17263129
Ancestral: C
Derived: T
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z140 F2642+ CTS6772,Y1996+ Y7623+ Y3656+ Branch
Forward Primer: A13249_F TCAGGACTTGACCTCATTGC
Reverse Primer: A13249_R TGTTTGAACATCCCACATAACC
Reviews

Customers who bought this product also purchased
A13243
A13243
A13242
A13242
A13240
A13240
A14744
A14744
I1 McBryde Family Panel
I1 McBryde Family Panel
A13247
A13247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies