Top » Catalog » SNPs » A14744

$18.00

A14744
[A14744]

A14744
hg38 Position: ChrY:6823868..6823868
Ancestral: C
Derived: A
Reference: William Hartley (2017)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z140 F2642+ CTS6772+ Y3649+ Y3647+ Branch
Forward Primer: A14744_F TAGGACTGTGTTGAAGAGGAGTGAC
Reverse Primer: A14744_R CAAAAATCATCAAGAAAATATGAGCC
Reviews

Customers who bought this product also purchased
A13247
A13247
A13244
A13244
A13243
A13243
A13242
A13242
A13240
A13240
A13249
A13249
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies