Top » Catalog » SNPs » BY35640

$18.00

BY35640
[BY35640]

BY35640
hg38 Position: ChrY:12582569..12582569
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > YP1337
Forward Primer: BY35640_F AACATCCTGGGGTTACAGGC
Reverse Primer: BY35640_R TGCTTTTTAACTGGATGTGATTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies