Top » Catalog » SNPs » BY35642

$18.00

BY35642
[BY35642]

BY35642
hg38 Position: ChrY:12938686..12938686
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > YP1337
Forward Primer: BY35642_F CACATGCAGTGGTGAGAAAC
Reverse Primer: BY35642_R TGTTCGAGGAAGCAACTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies