Top » Catalog » SNPs » BY35646

$18.00

BY35646
[BY35646]

BY35646
hg38 Position: ChrY:13770421..13770421
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > YP1337
Forward Primer: BY35646_F TCCAACAGCTACAACAGTTAAGG
Reverse Primer: BY35646_R TTTGTCACCCCTAAAAGAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies