Top » Catalog » SNPs » Y112415

$18.00

Y112415
[Y112415]

Y112415
hg38 Position: ChrY:21677491..21677491
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: Below M458 > YP1337
Forward Primer: Y112415_F CACGCTGTCACCTCTCACTC
Reverse Primer: Y112415_R TGCTCAATTAAAAGTGAGAAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies