Top » Catalog » SNPs » Y132946

$18.00

Y132946
[Y132946]

Y132946
hg38 Position: ChrY:6990715..6990715
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > YP1337
Forward Primer: Y132946_F GGAGCATGTGGGGAGACAG
Reverse Primer: Y132946_R ATTTCTGCAAAGATTTCTGCATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies