Top » Catalog » SNPs » FGC19058

$18.00

FGC19058
[FGC19058]

FGC19058
hg38 Position: ChrY:20896449..20896450
Ancestral: del
Derived: ins
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a-CTS4385
Comments: Aka Y2895
Forward Primer: FGC19058_F TGCAAATCAGACACCACCTC
Reverse Primer: FGC19058_R GTGGGGCAGAAACAAATCAC
Reviews

Customers who bought this product also purchased
S23297
S23297
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies