Top » Catalog » SNPs » S928

$18.00

S928
[S928]

S928
hg38 Position: ChrY:13398938..13398938
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Downstream S868
Forward Primer: S928_F CCAAAAATTTAAAATAGGCAAAGG
Reverse Primer: S928_R CTCAAACTCCCTGGCAGAAG
Reviews

Customers who bought this product also purchased
FGC41901
FGC41901
Z2195
Z2195
BY13693
BY13693
A10499
A10499
Z255
Z255
Z29749
Z29749
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies