Top » Catalog » SNPs » FGC74346

$18.00

FGC74346
[FGC74346]

FGC74346
hg38 Position: ChrY:17039241..17039241
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: I1
Comments: Downstream Z140 > L338
Forward Primer: FGC74346_F AGACAGGGCCTCACTGTGTC
Reverse Primer: FGC74346_R TGCCAAGTCTAGATGGTTTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies