Top » Catalog » SNPs » FGC74347

$18.00

FGC74347
[FGC74347]

FGC74347
hg38 Position: ChrY:17359817..17359817
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: I1
Comments: Downstream Z140 > L338
Forward Primer: FGC74347_F GAATCAGGGACCCACTGAAC
Reverse Primer: FGC74347_R CACATGTGCACCTGCTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies