Top » Catalog » SNPs » FGC74350

$18.00

FGC74350
[FGC74350]

FGC74350
hg38 Position: ChrY:19381228..19381228
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: I1
Comments: Downstream Z140 > L338
Forward Primer: FGC74350_F CCTGCATGCCTTACATTTTG
Reverse Primer: FGC74350_R CCGTGGAAGACAGTGTGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies