Top » Catalog » SNPs » FGC8403

$18.00

FGC8403
[FGC8403]

FGC8403
hg38 Position: ChrY:19074650..19074650
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC8403_F AGTTGAATTGCACAGACATTCC
Reverse Primer: FGC8403_R GCAATGAGCCCATCATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies