Top » Catalog » SNPs » PF5456

$18.00

PF5456
[PF5456]

PF5456
hg38 Position: ChrY:19971804..19971804
Ancestral: G
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: not listed
Comments: Downstream L70. downstream CTS3601
Forward Primer: PF5456_F CAACCAACAGACAGAGCCATAG
Reverse Primer: PF5456_R GGGCATTCTTGTCTTGTACTTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies