Top » Catalog » SNPs » Z2185

$18.00

Z2185
[Z2185]

Z2185
hg38 Position: ChrY:17068585..17068585
Ancestral: A
Derived: T
Reference: Greg Magoon 2012
ISOGG Haplogroup: R1b1a1a2a1a2c1f2c
Comments: downstream of Z253; approx. with L1066
Forward Primer: GCTATGACTCAAACTCCAAAAAGG
Reverse Primer: GCCTGTTTGACACTCCTGTTC
Reviews

Customers who bought this product also purchased
Z2195
Z2195
BY13693
BY13693
A10499
A10499
FGC41901
FGC41901
FGC5639
FGC5639
Z2188
Z2188
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies