Top » Catalog » SNPs » Y32084

$18.00

Y32084
[Y32084]

Y32084
hg38 Position: ChrY:8716744..8716744
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Below PH908
Forward Primer: Y32084_F AGAGGGAGGGCCAGTGAG
Reverse Primer: Y32084_R GAAGCACATGGGTTACCTCAG
Reviews

Customers who bought this product also purchased
FT14506
FT14506
BY191770
BY191770
BY189804
BY189804
BY135769
BY135769
Y51673
Y51673
Y52621
Y52621
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies