Top » Catalog » SNPs » Y32084

$18.00

Y32084
[Y32084]

Y32084
hg38 Position: ChrY:8716744..8716744
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Below PH908
Forward Primer: Y32084_F AGAGGGAGGGCCAGTGAG
Reverse Primer: Y32084_R GAAGCACATGGGTTACCTCAG
Reviews

Customers who bought this product also purchased
A1328
A1328
BY183912
BY183912
A16413
A16413
Y14605
Y14605
Y6651
Y6651
A811
A811
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies