Top » Catalog » SNPs » Y32084

$18.00

Y32084
[Y32084]

Y32084
hg38 Position: ChrY:8716744..8716744
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Below PH908
Forward Primer: Y32084_F AGAGGGAGGGCCAGTGAG
Reverse Primer: Y32084_R GAAGCACATGGGTTACCTCAG
Reviews

Customers who bought this product also purchased
FT177529
FT177529
Y183467
Y183467
FT34699
FT34699
BY170650
BY170650
A493
A493
A5877
A5877
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies