Top » Catalog » SNPs » Y32084

$18.00

Y32084
[Y32084]

Y32084
hg38 Position: ChrY:8716744..8716744
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Below PH908
Forward Primer: Y32084_F AGAGGGAGGGCCAGTGAG
Reverse Primer: Y32084_R GAAGCACATGGGTTACCTCAG
Reviews

Customers who bought this product also purchased
FT355524
FT355524
BY125046
BY125046
FT355750
FT355750
BY111699
BY111699
Y48599
Y48599
A13910
A13910
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies