Top » Catalog » SNPs » Y32084

$18.00

Y32084
[Y32084]

Y32084
hg38 Position: ChrY:8716744..8716744
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Below PH908
Forward Primer: Y32084_F AGAGGGAGGGCCAGTGAG
Reverse Primer: Y32084_R GAAGCACATGGGTTACCTCAG
Reviews

Customers who bought this product also purchased
FT277419
FT277419
Z16983
Z16983
PH3314
PH3314
Y30726
Y30726
S10860
S10860
Z2582
Z2582
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies