Top » Catalog » SNPs » FGC57542

$18.00

FGC57542
[FGC57542]

FGC57542
hg38 Position: ChrY:14876442..14876442
Ancestral: A
Derived: G
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: R2
Comments: .
Forward Primer: FGC57542_F GCTTGACATTTTTCCCAAGG
Reverse Primer: FGC57542_R TGGGAGGAATAAAAAGCATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies