Top » Catalog » SNPs » FGC57544

$18.00

FGC57544
[FGC57544]

FGC57544
hg38 Position: ChrY:19335738..19335738
Ancestral: T
Derived: C
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: R2
Comments: .
Forward Primer: FGC57544_F TAGTAGCCAGTTGGGTTTGG
Reverse Primer: FGC57544_R AAATTCAACAACCCTTCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies