Top » Catalog » SNPs » Y30806

$18.00

Y30806
[Y30806]

Y30806
hg38 Position: ChrY:7914441..7914441
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: I1
Comments: Below L22 > L813
Forward Primer: Y30806_F TCTCCCTCATTAGACTCAGGTGAG
Reverse Primer: Y30806_R TCTTTTGTCTTTAGTCACAACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies