Top » Catalog » SNPs » A22304

$18.00

A22304
[A22304]

A22304
hg38 Position: ChrY:12787228..12787228
Ancestral: C
Derived: A
Reference: Floyd Owsley (2018)
ISOGG Haplogroup: R1b
Comments: Downstream BY4140
Forward Primer: A22304_F TTTGAGTGAACTTCCCAGTCTC
Reverse Primer: A22304_R TCCAGTCACTATCCAAATTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies